A STAB VIDA offers you the Premium option for Sanger DNA sequencing, leveraging its strong and extensive experience in this field to provide you with quality results.

Our Premium protocols have successfully sequenced hundreds of thousands of PCR products, plasmids, and other DNA constructs for clients from universities, hospitals, industry, and SMEs at a competitive price.

You need to send your DNA and primers in separate tubes. We will then proceed with quantification and preparation of the sequencing mixture.

Sample Requirements:

• PCR Products (purified) ≥ 20 ng/µL (minimum volume of 15 µL)
• Plasmids   ≥ 100 ng/µL (minimum volume of 15 µL)
• Primer - 10 pmol/µL em ddH₂O (minimum volume of 5 µL)

Take advantage of the opportunity to use our extensive list of UNIVERSAL PRIMERS and enjoy  FREE RESEQUENCING.

Results in 24/48h!

Contact us: sales@stabvida.com | tel: +351 210438606 | skype ID: Sales from STAB

"You Tube It" is a low-cost service provided by STAB VIDA for DNA sequencing using the Sanger method. It is a simple and economical option. Prepare the mixture yourself (DNA + Primer) following our recommendations (confirm in the table below) and place one of our barcodes on each tube or plate. You can request the barcodes for free (online or call us directly).

"You Tube It" and "You Plate It" are our innovative services where you perform half of the protocol, and we complete the rest of the work!

Results within 24/48h!

Requirements for Shipping:

	PCR Product	Plasmid < 10 kb	Plasmid > 10 kb
Start with: 10 μL DNA (Purified)	≥ 20 ng/μL	100 ng/μL	500 ng/μL
Add: 3 μL Primer	10 pmol/μL	10 pmol/μL	10 pmol/μL

Note: You Tube It / You Plate It reactions do not include free resequencing.

Contact us: sales@stabvida.com | tel: +351 210438606 | skype ID: Sales from STAB

For the Run Only sequencing service, mix the DNA, primers, and Big Dye in the correct quantities. Once received in our laboratories, STAB VIDA processes your reactions on ABI 3730 xl sequencers.

This is the lowest-cost option for your sequencing project.

Results in 24h!

Sample requirements:

• Samples should be prepared under standard conditions on a sequencer.
• The used kit Big Dye kit must be specified.

Contact us: sales@stabvida.com | tel: +351 210438606 | skype ID: Sales from STAB

The prepaid packages for our DNA sequencing services come in two options: 100 reactions Premium or 50 reactions You Tube It.

Easy ordering process: Save money by purchasing multiple sequencing reactions. Save time, logistics, management, and costs, as it will be billed in a single transaction.

You can monitor the usage of your package online and track its transaction history. Each time an order is placed with STAB VIDA, the reactions equivalent to the respective package are automatically deducted.

On the other hand, our packages have no expiration date, nor is there a minimum quantity of reactions per order.

Contact us: sales@stabvida.com | tel: +351 210438606 | skype ID: Sales from STAB

Contact us: sales@stabvida.com / tel: +351 210438606 / skype ID: Sales from STAB

ITS and 16S rRNA target sequencing constitute well established amplicon sequencing methods used to identify and compare bacteria or fungi. These are proven methods for comparing sample phylogeny and taxonomy from complex microbiomes or environments. Additional targets, as CO1 can also be used for characterization of other species. Our standard 16S protocol amplifies the V3-V4 region, using the following primer pair: • 341F - CCTACGGGNGGCWGCAG • 785R - GACTACHVGGGTATCTAATCC Our standard ITS protocol amplifies the ITS1 region, using the following primer pair: • ITS1f - CTTGGTCATTTAGAGGAAGTAA • ITS2 - GCTGCGTTCTTCATCGATGC Either using our standard targets or personalized ones, we can help you get the most information possible out of your samples. We might help you achieve this, through our QIIME2 based Metagenomics bioinformatics analysis service.

Contact us: sales@stabvida.com | tel: +351 210438606 | skype ID: Sales from STAB

RNA-seq allows the detection and identification of nearly every class of molecules transcribed. Analyse whole transcriptomes in order to study gene expression analysis or marker discovery. RNA-seq doesn´t require prior knowledge of gene sequences. Get complete coverage of transcriptome and find information about exon structure and alternative splicing events.

mRNA-Seq

The mRNA-Seq library is based on an enrichment of polyadenylated mRNA. This. Poly(A) enrichment provides a high-sensitive option for detection of coding transcripts in samples without degradation.

Whole Transcriptome

The whole transcriptome library is based on rRNA depletion, enriching the sample for both mRNA and non-coding RNAs. This rRNA depletion strategy is great for samples that display a moderate degree of degradation.

Small RNA

Poly-A enrichment and complete transcriptome-based preparation methods do not allow an adequate evaluation of the Small RNAs, which require a specific sample preparation protocol, followed by an appropriate size selection. By following this specific protocol we can offer a complete service of discovery and profiling of Small RNAs.

The RNAseq data can then be serve multiple purposes, with our standard bioinformatics analysis service being suitable to characterize gene expression and differential gene expression.

Contact us: sales@stabvida.com | tel: +351 210438606 | skype ID: Sales from STAB

Single Species

Whole-genome sequencing (WGS) is a complete method for analysing entire genomes, providing the most comprehensive analysis of genome variance and structure. The WGS data can than be suitable for de novo assembly, annotation, or Mapping to reference & variant detection approaches, depending on the aim of the study.

Whole Genome Metagenomics (WGM)

Whole Genome Metagenomics (WGM), or shotgun metagenomic sequencing, is a powerful sequencing approach that provides insight into community biodiversity and function. Ultimately, the WMS seeks the sequencing all the genomes present in the samples. Dealing with all the generated information might be challenging, so you can also take advantage of our bioinformatics analysis service to help you get the most out of your data.

Lidar com toda a informação gerada pode ser um desafio, por isso também pode aproveitar o nosso serviço de análise de bioinformática para ajudá-lo a tirar o máximo partido dos seus dados.

Contacte-nos: sales@stabvida.com | tel: +351 210438606 | skype ID: Sales from STAB

Whole Exome Sequencing (WES) intends to sequence the exonic regions of the genome. Despite constituting approximately only 1% of the human genome, most disease-related variants occur within this protein coding regions of the genome. With Exome sequencing you’ll be able to achieve high confidence variant calls and explore what they mean, either with comparison with appropriated databases or predictive analysis. To achieve this, you can make use of our bioinformatics service, that goes from mapping to reference to the variant calling and variant annotation with multiple databases.

Contact us: sales@stabvida.com | tel: +351 210438606 | skype ID: Sales from STAB

Run Only Our Run Only Service is designed for customers who prefer to prepare their own libraries and thus have greater control of the entire process, or who want to prepare libraries using in-house workflows. Epigenetics DNA methylation is an important epigenetic mechanism capable of influencing the gene expression and structure of chromatin. The study of these mechanisms has particular relevance because methylation dysregulation is closely associated with multiple diseases. To enable this study, STABVIDA offers services of: • Whole Genome Enzymatic Methylation Sequencing (WGEMS) – Allows you to detect cytosine methylation patterns throughout the genome, including cpG, CHH and CHG. • Reduced Representation Bisulfite Sequencing (RRBS) - Consists of a way to sequence only CpG-rich regions of the genome through digestion with restriction enzymes. Immunoprecipitate chromatin sequencing (ChIP-seq) is a method that allows the analysis of interactions between proteins and DNA. With our ChIP-seq service you can efficiently and accurately detect protein binding sites of interest, especially transcription factors and other chromatin-associated proteins.

Contact us: sales@stabvida.com | tel: +351 210438606 | skype ID: Sales from STAB

Contact us at: sales@stabvida.com | tel: +351 210438606 | skype ID: Sales from STAB